Patent Watch April 2025 - July 2025

Title

Patent Watch - August 2025

Publish Date

This article summarizes selected patents in the area of controlled release or delivery that were published from April 22, 2025 through July 29, 2025. Greater detail on each of these patents is given on the U.S. patent website Patent Public Search | USPTO

 General/Industrial Applications

US- 12372503- Multifunctional Magnetic Tags for Mud Logging

Nanoparticle tags with superparamagnetic iron oxide cores, fluorescent intermediate layers, and polymer shells are used to trace subterranean sample origins. Samples are tagged, fluid flows introduce tags to formations, and magnets separate tagged samples. Analyzing the fluorescent signal identifies origin locations.

US- 12371344- Ferric Oxide Nanoparticles for Wastewater Disinfection

Method for synthesizing ferric oxide nanoparticles involves using Rosa rugosa cv. plena (RP) extract, adding it to a ferric chloride solution, and activating phytochemicals to produce phyto-synthesized Fe₂O₃ nanoparticles.

US- 12370532- Method Of Manufacturing Metal Oxide Gas Sensor Functionalized By Multicomponent Alloy Nanoparticle-perovskite Composite Catalyst

Composite structure with uniform metal nanoparticles on perovskite oxide bonded to metal oxide supports (sensing materials). Offers improved durability and enhanced performance in gas sensors for detecting target gases efficiently.

US- 12370530-  

Yolk/shell-type CoₓCu₁₋ₓCo₂O₄@CoyCu₁₋ₓCo₂O₄ Catalyst, Preparation Method, and Application to Catalytic Hydrogen Generation

This invention discloses a catalyst for hydrogen generation via ammonia borane hydrolysis. The simple, cost-effective synthesis involves hydrothermal synthesis of a cobalt complex, calcination to form Co₃O₄ microspheres, Cu²⁺ adsorption, and further calcination. The resulting catalyst is pure, high-performing, and exhibits excellent catalytic activity.

 

US- 12351517-  Method For Preparing Silane Coupling Agent/silica/plant Fiber Composite

A method involves: S1: pretreating plant fiber; S2: preparing silane coupling agent hydrolysate; S3: forming a silane/plant fiber composite; S4: preparing a silica nanoparticle dispersion; S5: creating a silane/silica/plant fiber composite. Covalent interactions graft silica nanoparticles onto fibers, providing hydrophobic protection and stability. Reduces fiber alkalinity and calcium hydroxide content, suitable for building materials.

US- 12338336 -  Thermally Expandable Cellulose-based Microspheres

Thermally expandable microspheres feature a polymeric shell with carboxylate-functionalized cellulose (Tg ≥125°C) and a blowing agent core. The preparation method involves mixing an aqueous phase, possibly with emulsifier, and an organic phase containing solvent, blowing agent, and cellulose, forming a microsphere dispersion.

US- 12338210 -  Degradable Polymers and Monomers Therefor

Describes the preparation and use of hydroxy acetal/ketal monomers for degradable polymers, generating hydroxy-functional intermediates while avoiding energy-intensive polyurethane degradation and repurposing materials like polyurethanes and melamines. Incorporates photoacid generators in microcapsules for UV-triggered, controlled release of oil-based agents such as flavors, fragrances, or biocides.

US- 12318748 -  Microcapsules For Use with Polyurethane And Epoxy Adhesives

Microcapsule for underwater adhesive has a nano clay and polyurea shell, encapsulating a core with a base catalyst, polyol, and hydrophilic solvent for polyurethane formation.

US- 12312535 -  Functionalized Nanoparticles And Polymers For Foamer Applications In Upstream Environments

Functionalized foaming agents, containing nanoparticles, polymers, or both, and donor molecules like organosilicon or alkyl halides to stabilize foaming agents for petroleum recovery. 

US- 12297148 -  Self-repairing Cement Including Microcapsule-in-microcapsule Material And Designed Swellable Rubber And Methods For Fabricating Same

Self-repairing cement compositions feature microcapsule encapsulated microcapsules (MIM). Both shells can be cross-linked. Methods to prepare these MIM materials and self-healing cement slurries that include cement, sand, water, and MIM are provided.

US- 12286879-  Oil Field Chemical Release System

An oil field chemical release system for controlled release in hydrocarbon reservoirs, wells, or wellbores comprises microcapsules containing an oil field chemical, embedded in a continuous bulk polymer matrix. The system releases the chemical at a controlled rate, ensuring an effective release profile into the target area.

 

Agriculture

US- 12349702- Microcapsule Comprising Choline Chloride and Method for Preparing The Same

A microcapsule with a core of choline chloride and carrier, an inner membrane of vegetable fat (melting point ≥ 60°C), and an outer membrane of rice bran wax, zinc oxide powders, and a film-forming material (glucose phthalate, polyethylene glycol, or sodium alginate). The rice bran wax constitutes 5-10 wt.%, with a mass ratio of 1-5:0.1-1:0.1-1.

US-12302897- Microcapsule Composition, Method for Manufacturing Same, Agrochemical Formulation Comprising Same and Weed Control Method

The invention provides a microcapsule composition to reduce or prevent pyroxasulfone-induced plant injury, including production and weed control methods. Pyroxasulfone is encapsulated via a high-speed emulsifying dispersion of its crystal particles with isocyanate, oily, and aqueous phases, and subsequent film formation on emulsion particles.

US- 12342816- Composition For Fertilization and Treating Trees, Shrubs And Climbing Plants With Programmed Release Of The Active Substance That At The Injection Location Induces Formation Of A Clump Of Young Roots That Become The Mouth Of The Tree

The disclosed composition uses nanoencapsulation or microencapsulation for controlled release of active substances. It can acidify soil (pH 2.5-6.5) using ecological citric acid or regulate soil acidity (pH 6.5-7.0). The capsules may contain insecticides, fungicides, acaricides, pheromones, or repellents, providing targeted fertilization and treatment for trees, shrubs, and climbing plants.

US- 12295364- Nano Pesticidal Formulation and Preparation Method Thereof

Pertains to a pesticidal formulation comprising EPA-approved Minimum Risk Pesticides, including nanoscale iron/oxide and silica encapsulated within micelles. Additives include corn, soybean, cinnamon, and peppermint oils , inert ingredients like bentonite, lauryl sulfate, sodium lauryl sulfate, malic acid, vinegar, and white mineral oil as carriers, stabilizers, surfactants, and emulsifiers. Preparation involves micelle formation, nanoparticle encapsulation.

 

Diagnostic/Sensing

US- 12365903- Application Of Aptamer in Recognition and Binding Of Alkaline Phosphatase Heterodimer Or Tumor Detection

The invention involves an aptamer for recognizing and binding alkaline phosphatase heterodimer. The aptamer, a single-stranded DNA, enables highly selective capture and detection of circulating tumor cells, exosomes, and free alkaline phosphatase in peripheral blood using magnetic nanoparticle technology.

US- 12360107- Synthesis Of NanoSCINT Particles

This invention provides a method to produce nanocomposite particles for scintillating proximity assays. It involves batch addition of polymerization initiators to an emulsion with a high amount of polymerizable organic compound, forming an organic polymer nanoparticle doped with scintillating compounds, encapsulated in a silica shell. 

US- 12357581- Nanoparticles Comprising Copolymeric or Homopolymeric Compounds Which Comprise Cyanoacrylate Subunits

The invention describes nanoparticles with copolymeric or homopolymeric compounds containing cyanoacrylate subunits with various R¹ groups (e.g., 2-ethylhexyl, neopentyl, 3-methylbutyl). These nanoparticles include an active agent and are used in therapeutic or diagnostic applications, including cancer treatment, infection, and diagnostic imaging.

US- 12345706- Detection Kit and Preparation Method Thereof and A Detection Method for Novel Coronavirus

The disclosure presents a novel coronavirus detection kit and method, featuring an antigen test strip. The strip includes a substrate, bibulous paper, nitrocellulose membrane, microsphere pad. The pad is coated with latex microsphere-labeled SARS-CoV-2 monoclonal antibody, while the membrane has a test line with monoclonal antibody and a quality control line with goat anti-mouse IgG polyclonal antibody. The kit employs latex particles and antigen-antibody reaction via lateral chromatography for analysis.

US- 12339286- Metal-reducing Enzymatic Tag for Optical and Electron Microscopy

This invention involves fusing an Se-binding peptide to an enzyme reducing selenite (SeO₃²⁻) to Se⁰ nanoparticles (SeNPs), controlling their size and maintaining enzyme association. This fusion enhances the enzyme's reductase activity without external peptide addition, and the peptide's His-based ligation induces a conformational change for improved binding to the particle. The method is crucial for producing size-specific SeNPs efficiently.

US- 12326449-  

Fibrinogen Biological Material Detection Sensor Including an Erythrocyte Membrane Covered Metal Nanoparticle and Fabricating Method Thereof

A biomaterial detection sensor that includes a metal nanoparticle covered by an erythrocyte membrane. This configuration enables the probe to selectively react with fibrinogen.

US- 12324844- MRI Contrast Agent Including T1 Contrast Material Coated On Surface Of Nanoparticle Support

The MRI T1 contrast agent includes T1 contrast material coated on nanoparticle supports to enhance T1 spin magnetic relaxation. By optimizing the thickness and diameter of the paramagnetic material on the nanoparticles, the surface-to-volume ratio is significantly increased, resulting in clearer and more precise T1 positive contrast images improving the reliability of image diagnosis.

US- 12305097- Fluorescent Silica Nanoparticles Using Silane-lanthanum-base Complex Composite And Cross-linking Reaction And Method For Manufacturing Same

A method to manufacture lanthanide fluorescent silica nanoparticles involves synthesizing a silane-lanthanide chelate complex, forming a water-in-oil microemulsion with this complex, introducing a silica precursor, and synthesizing nanoparticles by crosslinking within the micelles. The resulting nanoparticles are useful for fluorescence analysis of inorganic and bio-derived materials.

 

Pharma

US- 12370145- Therapeutic Agent Nanoparticles and Methods of Preparation

This invention comprises a microparticle with a pharmaceutically acceptable excipient, coated with nanoparticles of a therapeutic agent. 

US- 12365921- Lipid Nanoparticle

Pertains to a lipid nanoparticle which comprises a lipid component, a DNA nuclease, a guide RNA and a single-stranded oligonucleotide, consisting of a pH-sensitive cationic lipid, a neutral phospholipid and a polyalkylene glycol-modified lipid.

US- 12364772- Conjugates Comprising Nanoparticles Coated with Platinum Derivatives Through Sulfonyl or Phosphonyl-containing Linkers

Description of conjugates having colloidal stability in a medium comprised of a nanoparticle of gold, silver or platinum, a plurality of linkers containing a sulfonyl moiety or a phosphonyl moiety and groups attached to the linkers for the treatment of cancer. 

US- 12357602- Compositions Comprising Encapsulated Tretinoin

The present application is directed to compositions comprising microcapsules comprising encapsulated tretinoin, wherein the microcapsule size is less than 50 μm; and to methods of use thereof.

US- 12357572- Powder Composition Based on Microparticles Embedding Nanoparticles for The Delivery Of Therapeutic/diagnostic Compounds

A powder composition for inhalation comprising microparticles with at least one water-soluble pharmaceutically acceptable carrier embedding a nanoparticle of calcium phosphate for the delivery of therapeutic/diagnostic compounds.

US- 12351834- Compositions And Methods for The Treatment of Ornithine Transcarbamylase Deficiency

Describes treating ornithine transcarbamylase (OTC) deficiency using a lipid formulation and messenger RNA encoding an OTC enzyme. 

US- 12350336- Photo-activatable Compound, Its Preparation and Therapeutic Use

A nanoparticulate pharmaceutical formulation consisting of an active ingredient and a pharmaceutically acceptable carrier for treatment of a target tissue by radiation-induced activation of the active compound.

US- 12343434- Hybrid Membrane Camouflaged Nanomedicine Loaded with Oxidative Phosphorylation Inhibitor and Preparing Method Thereof

The disclosure presents a hybrid membrane camouflaged nanomedicine loaded with an oxidative phosphorylation inhibitor. It consists of a ROS-responsive drug-loaded inner core and an outer shell made from mitochondrial and cancer cell membranes. This design allows the nanomedicine to cross the BBB, target tumor sites, and specifically enter mitochondria releasing the inhibitor for therapy of GBM.

US- 12343429- Method Of Delivery Of DNA Or RNA Cargo Unshielded Lipid Nanoparticles And Compositions Thereof

The disclosure provides unshielded lipid nanoparticles and a production process that prevents particle aggregation. These nanoparticles include a nucleic acid cargo, sterol, neutral lipid, and ionizable cationic amino lipid. The nanoparticles are non-sterically stabilized with a hydrophilic polymer-lipid conjugate or unshielded.

US- 12343396- Ultrasound Mediated Delivery of Drugs

The invention concerns ultrasound-mediated delivery of therapeutic agents, utilizing a bi-phasic microparticle system of gas microbubbles, emulsion microdroplets, and their clusters. It includes compositions for delivering drugs, genes, nanoparticles, or radioisotopes, and serves as a contrast agent. 

US- 12337039- Room Temperature Stable, Single Shot MRNA Vaccine For COVID-19

Introduction of a room temperature-stable mRNA COVID-19 vaccine that requires only one injection and reduces hypersensitivity. It involves double nanoencapsulation: first in phospholipid nanosomes, then in biodegradable polymer nanospheres, using a solvent-free supercritical fluid process. 

US- 12329855- Drug Delivery System with Enhanced Immune Active Function

A composite nanoparticle in which an immunogenic plasma protein is coated on the nanoparticle.  

US- 12329822- Antimicrobial Tailored Chitosan

The invention relates to a bio-conjugate comprising a chitosan derivative coupled to an antimicrobial peptide (AMP) for use in the treatment or prevention of a microbial infection, for example in wound healing. The invention also provides a nanoparticle formulation or a gel/hydrogel formulation or a lyophilized foam formulation comprising the bio-conjugate of the invention.

US- 12329765- Targeted Nanoparticle for The Treatment of Traumatic Brain Injury And Other CNS Diseases

A nanoparticle-based minocycline formulation for targeting drug delivery to treat central nervous system injuries. At minimal doses, these albumin nanoparticles containing minocycline cross the blood-brain barrier at higher concentrations compared to free minocycline reducing neurotoxicity

US- 12319711 - Spherical Nucleic Acids With Tailored And Active Protein Coronae

The disclosure pertains to spherical nucleic acids (SNAs) with a protein corona, including a nanoparticle core and surface-attached oligonucleotides, surrounded by multiple proteins. It offers methods for enhancing stability and extending blood circulation half-life of SNAs by adsorbing proteins onto the SNA surface for biomedical application.

US- 12318489- Nanoparticle Formulations For Delivery Of Nucleic Acid Complexes

Nanoparticle formulations for delivery of oligonucleotides or synthetic RNA resulting in posttranscriptional protein and RNA level alterations for therapeutic applications.

US- 12318475- Injectable Pastes Based on Oppositely Charged Polymer/calcium Phosphate Nanoparticles

Polymer-stabilized CaP nanoparticle formulations with calcium and phosphate ions with an ionic polymer, resulting in stable hybrid nanoparticles in powders, suspensions, or injectable pastes. 

US- 12303569- Lipid Nanoparticle Compositions and Uses Thereof

The present invention provides a lipid nanoparticle (LNP) formulation comprising at least one sialic acid (SA)-containing lipid. The formulation is capable of effectively binding cell surface Siglecs, transfecting certain cells in vitro and targeting certain cells in vivo. The present invention also provides methods of using the LNP compositions described herein for pharmaceutical applications. 

US- 12280159- Therapeutic Protein-based Nanoparticles for Treating Cancer

Protein-based nanoparticles are developed for treating cancer, specifically intracranial tumors, using electrohydrodynamic jetting. These nanoparticles consist of water-soluble proteins (8-700 kDa) and may be cross-linked to form a mesh structure (1-4 nm). They can encapsulate therapeutic nucleic acids. 

 

Bio

US- 12370266- Polymer Composite Nanomaterial Encapsulation System

Polymer nanomaterial encapsulation systems produce polymer-encapsulated nanoparticles with a hydrophobic nanoparticle core and an external hydrophilic polymer ensuring water solubility and functionalization. Examples include quantum dots, superparamagnetic iron oxide nanoparticles, and upconverting nanoparticles, encapsulated in polystyrene-b-polyethylene glycol amine. These nanoparticles can be conjugated with antibodies to capture cellular targets.

US- 12357932- Air Filtration Media Having Metal Nanoparticle Agglomerates Adhered Thereto, Formation Thereof and Use Thereof

Metal nanoparticle agglomerates impart biocidal activity to surfaces by adhering to fibers. These agglomerates consist of fused, partially fused, or unfused metal nanoparticles, such as copper and silver, protecting against pathogens. Applications include masks, inline filters, and air filtration systems.

US- 12357583- Magnetoelectric Nanocomposites and Method of Preparation Thereof

A magnetoelectric nanocomposite (MEN) is designed for colorectal cancer treatment. It features a shell with a ferroelectric compound and a rare earth-doped spinel ferrite nanoparticle core, one component being cerium, europium, gadolinium, terbium, or thulium. 

US- 12350381- Nanoparticles Containing Cellular Membrane and Uses Thereof

Nanoparticles with an inner core and an outer shell made from a cellular membrane while the core does not support the membrane. 

US- 12343433- Microencapsulation Method for Improving Stability of Anthocyanin, Product Therefrom and Use Thereof

The invention provides a microencapsulation method to enhance anthocyanin stability.The process involves: (1) creating a wall material gel system with sodium alginate and calcium carbonate; (2) mixing this with an anthocyanin solution to form the water phase; (3) emulsifying the water phase with an oil to get a W/O emulsion; (4) acidifying the emulsion, mixing with a salt buffer, letting it stand, and separating the phases.

US- 12336546- Antibacterial Glucose-based Composite Nanoparticle and Processing Method and Use Thereof

The disclosure presents an antibacterial glucose-based composite nanoparticle and its processing method, enhancing modern food processing. Utilizing surface positioning modification and charge transfer technologies, the nanoparticles (50-1,000 nm, zeta potential 0 to -10 mV) achieve over 98% broad-spectrum antibacterial rate.

US- 12329831- Radionuclide-loaded Nanoparticles for Focal Tissue Ablation

Radiopharmaceutical compositions with a radionuclide and imaging agent encapsulated in or attached to nanoparticles via a chelator. These are designed for direct administration to diseased tissue, minimizing washout to non-target sites. This approach enables efficient treatment with minimal damage to surrounding tissue.

US- 12329795- Composition For Weight Reduction and Body Fat Reduction, Preparation Method and Application Thereof

A composition for weight and body fat reduction includes concentrated milk protein, soybean isolated protein powder, whey protein powder, skim milk powder, collagen peptide, extracts of Agaricus bisporus, Flammulina velutipes, okra, Opuntia ficus-indica, medium chain triglyceride microcapsule powder, mango concentrate powder, ginger oil microcapsule powder, citrus powder, guarana extract, and compound vitamins. It relates to health food and encompasses preparation and application methods.

US- 12291461- Cerium Oxide Nanoparticle, Dispersion Body, Oxidant, Antioxidant, And Method of Producing Cerium Oxide Nanoparticle

A cerium oxide nanoparticle is created by mixing a solution of an aromatic heterocyclic compound, with potential substituents like methyl, ethyl, amino, aminomethyl, monomethylamino-, dimethylamino-, or cyano- groups, containing 2-8 carbon atoms and 1-4 nitrogen atoms in its ring structure, with a solution containing cerium (III) ions or a cerium (III) salt, then adding an oxidant.

US- 12290068- Single Cell Encapsulation Via Pickering Emulsion for Bio-pesticides Application

This invention provides a system and methods for single cell microencapsulation by Pickering emulsion.

US- 12280139- Microparticles/microcrown

The method for producing a microparticle involves a mold assembly with an upper and lower mold. In the closed position, the molds create a micro-cavity to press the molding material into a microparticle. In the open position, the microparticle adheres to one of the molds for easy removal.

 

Consumer Products/ Cosmetics

US- 12344996- Bio-based Waterproof and Oil-proof Wrapping Paper and Preparation Method Thereof

A bio-based waterproof and oil-proof wrapping paper is presented involving: (1) soaking base paper in calcium chloride solution, then drying it; (2) creating a sodium alginate solution with sodium alginate, a plasticizer, and water, and a chitosan solution with acetic acid, chitosan, a plasticizer, and a crosslinking agent; coating the pretreated base paper with the alginate solution, drying it, then coating it with the chitosan solution and drying it again to form a double-layer oil-proof paper; (3) adding nanoparticles to a biological wax solution and coating it onto the double-layer paper, followed by drying to achieve waterproof and oil-proof properties.

US- 12329846- Method For Preparing Microcapsule

A method for preparing microcapsules capable of selective release of oils and improving storage stability of the oil contained in the capsule.

US- 12303855- Stable Polyurea Microcapsule Compositions for Aldehyde Fragrances

Stable polyurea microcapsule compositions suitable for encapsulating aldehydes with a low viscosity. Also disclosed are consumer products containing such a composition and its preparation methods.

US-12285529- Method For Preparing Probiotic-loaded Microcapsule, Product Obtained from The Same, And Use of The Same

A method for preparing probiotic-loaded microcapsules using alginate and ionic gelation to encapsulate probiotics protected in acidic conditions.

US-12285515- Microcapsule And Hair Care Composition

A core shell microcapsule ith a liquid core and an outer shell, in which the liquid core comprises solvent and a piroctone compound and the shell comprises polyurea comprising amino sulphonic acid.

US-12285507- Deposition System for Hair

The hair treatment composition with a conditioning base with a cationic conditioning surfactant, and a fatty alcohol, microcapsules encapsulating a benefit agent in a polymeric shell, and diesterquat. This enhances microcapsule deposition and benefit agent delivery to hair surfaces. catattgcgcgcgaatatgcgcgcgaagcggatattaacggcacccatattagcattttttatgaaagcacccatgaaaacaccgaactgctgatggaa